BBa_K371056 1 BBa_K371056 ATG 2010-11-05T12:00:00Z 2015-05-08T01:12:16Z ATG ATG false false _498_ 0 3908 9 Not in stock false ATG false Hao Jiang annotation2113878 1 start codon range2113878 1 1 3 BBa_K371049 1 BBa_K371049 MPF(meta-prefix) 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z direct synthesis This part is a extention of BioBrick prefix. It is used in noval BioBrick assemble standard BBF RFC 53. false false _498_ 0 3984 9 Not in stock true BBF RFC53 false Yang Zhang annotation2105194 1 SacI range2105194 1 1 6 annotation2105192 1 SapI range2105192 1 3 9 annotation2105193 1 meta-prefix range2105193 1 1 10 annotation2105195 1 EarI range2105195 1 4 9 BBa_K371024 1 BBa_K371024 10*GS linker(for RFC 53 protein fusion) 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z This part is not long, so it can be easily get by direct annealing two oligonucleotides. This part is a short amino sequence used to link or fuse two protein domain together to make a large chimera protein. false false _498_ 0 3984 9 It's complicated true different codons of Gly and Ser was choosed in order to ignore the mismatch between forward sequence and reverse sequence when they are annealing. false Yang Zhang annotation2109630 1 10*GS range2109630 1 1 30 BBa_K371060 1 BBa_K371060 GGT 2010-11-05T12:00:00Z 2015-05-08T01:12:16Z GGT GGT, codon for glycine. false false _498_ 0 3908 9 Not in stock false GGT false Hao Jiang BBa_K371062 1 BBa_K371062 MPF-GGT-10*GS linker-ATG-PSF L-MetaPart 2010-11-05T12:00:00Z 2015-05-08T01:12:16Z synthesis MPF-GGT-10*GS linker-ATG-PSF L-MetaPart false false _498_ 0 3908 9 Not in stock false MPF-GGT-10*GS linker-ATG-PSF L-MetaPart false Hao Jiang component2113918 1 BBa_K371060 component2113920 1 BBa_K371024 component2113927 1 BBa_K371050 component2113917 1 BBa_K371049 component2113922 1 BBa_K371056 annotation2113920 1 BBa_K371024 range2113920 1 14 43 annotation2113918 1 BBa_K371060 range2113918 1 11 13 annotation2113927 1 BBa_K371050 range2113927 1 47 56 annotation2113917 1 BBa_K371049 range2113917 1 1 10 annotation2113922 1 BBa_K371056 range2113922 1 44 46 BBa_K371050 1 BBa_K371050 MSF(meta-suffix) 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z direct synthesis This part is a extention of BioBrick prefix. It is used in noval BioBrick assemble standard BBF RFC 53. false false _498_ 0 3984 9 Not in stock true BBF RFC53 false Yang Zhang annotation2105197 1 EarI range2105197 1 2 7 annotation2110071 1 stop codon range2110071 1 1 3 annotation2105196 1 BglII range2105196 1 6 10 annotation2105198 1 MSF range2105198 1 1 10 BBa_K371062_sequence 1 gagctcttcaggtggtagcggcagcggtagcggtagcggcagcatgtgaagagatc BBa_K371050_sequence 1 tgaagagatc BBa_K371024_sequence 1 ggtagcggcagcggtagcggtagcggcagc BBa_K371049_sequence 1 gagctcttca BBa_K371060_sequence 1 ggt BBa_K371056_sequence 1 atg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z