BBa_K372001 1 P170 acid tolerance growth phase inducible promoter 2010-10-18T11:00:00Z 2015-05-08T01:12:16Z from a vector - pAMJ399 ?? Madsen, S M. , et.al.; Molecular characterization of the pH-inducible and growth phase-dependent promoter P170 of Lactococcus lactis, Molecular Microbiology (1999), Vol 32 (1) This is a promoter which shows increased activity (above the baseline)in a specific range of pH i.e. between 5 and 6.5 and can be useful for reactions who's pH changes with time. false false _482_ 0 7679 9 It's complicated true no false Srivathsan A annotation2090268 1 P170 range2090268 1 4 54 annotation2090269 1 B0034 range2090269 1 58 69 BBa_K372001_sequence 1 gtgatttttggttgccatttgttaacgctgcctcctctccctagtgctataatacgcaaagaggagaaacac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z