BBa_K373000 1 BBa_K373000 PYY3-36 (Peptide Tyrosine Tyrosine, 3-36) 2010-10-26T11:00:00Z 2015-05-08T01:12:16Z This PYY3-36 Biobrick is derived from Homo Sapiens Peptide YY (mRNA RefSeq: NM_004160) PYY3-36 is an endogenous hormone produced in the ileum and colon or mammalian species, and postprandially released in proportion to the calories consumed during a meal. The peptide is absorbed into the circulatory system and passes the blood-brain barrier, where it contributes to the regulation of energy homeostasis. Acting as an agonist of the Y2-receptor (a member of the NPY family in the arcuate nucleus of the hypothalamus), PYY3-36 inhibits of gastric motility and reduces appetite. PYY3-36 is intended for use in projects exploring hormonal communication between gut microflora and the central nervous system in mammals. false false _494_ 0 5928 9 Not in stock false None. false Brian Burnley annotation2107954 1 Start range2107954 1 1 3 annotation2107955 1 Stop range2107955 1 106 111 annotation2107958 1 PYY3-36 coding region range2107958 1 4 105 BBa_K373000_sequence 1 atgtagtttgggctccgagggccgcttctgcggagcggcctcctcgacttggcgatgatgcggagggacgcggtgatggagttggaccagtgggccgtcgccatataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z