BBa_K374005 1 BBa_K374005 Lambda nutR site - N utilization site + Tr1 rho dependent terminator. 2010-10-16T11:00:00Z 2015-05-08T01:12:16Z nutR site from the lambda phage from E.coli. In lambda bacteriophage, gene expression is regulated by the suppression of transcription termination (antitermination) which is mediated by the lambda N protein that interacts with the nut site which is a cis-acting element [1]. This part contains the lambda nutR site which together with part (N part #) will suppress termination downstream regardless of what terminator is used. [1] Nudler, E. and Gottesman, M.E (2002). Transcription termination and anti-termination in E. coli. Genes to cells 7: 755-768. false false _520_ 0 6199 9 It's complicated false Requires a couple hundred base pairs upstream of the terminator. false Patrick Fortuna, Thomas Trolle, Anastasiya S. Haugaard, Martin Malthe Borch, Juliet Frederiksen annotation2088659 1 Rho utilization site A (rutA) range2088659 1 8 25 annotation2088703 1 Rho dependant tR1 range2088703 1 77 101 annotation2088702 1 Rho utilization site B (rutB) range2088702 1 41 60 annotation2088701 1 N utilization rightward range2088701 1 24 40 BBa_K374005_sequence 1 ataaccccgctcttacacattccagccctgaaaaagggcatcaaattaaaccacacctatggtgtatgcatttatttgcatacattcaatcaattgttatctaaggaaatacttacat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z