BBa_K374008 1 BBa_K374008 Gifsy1 promoters and Gifsy1 repressor gogR 2010-10-19T11:00:00Z 2015-05-08T01:12:16Z Genomic sequence from the Salmonella phage Gifsy1 Gifsy1 is a temperate phage present in many of the Salmonella enterica serovar Typhimurium strains. This part contains the Gifsy1 promoters and the Gifsy1 repressor. The promoters are divergent; consisting of pR[Gifsy1] and pRM[Gifsy1]. Downstream of the pRM[Gifsy1] promoter is the repressor gogR. gogR binds to the operator regions located between the two divergent promoters and is predicted to act both as an activator of the pRM[Gifsy1] and a repressor of the pR[Gifsy1]. The regulatory system is similar to the one found in lambda phages but induction is repressor cleavage independent. Instead small lexA regulated anti-repressor proteins bind to the repressor and prevents its DNA activity. The part has been used and tested in E. Coli. false false _520_ 0 7351 9 It's complicated true The part contains both promoters and repressor. We chose not to separate the repressor gene from the promoter because we wanted to keep the natural RBS. false Lisa Blanc Iversen, Maya Friis Kjaergaard, Annemi Jollmann, Anja Sander and Grzegorz Slodkowicz annotation2090382 1 pRM range2090382 1 403 408 annotation2090381 1 gogR range2090381 1 1 396 annotation2090383 1 pR range2090383 1 465 470 BBa_K374008_sequence 1 ttaatcttcgcgcgttcgaatccttcccttcatgtacttctcgtacatggcatccagttccttgagacgaagcgataatacccgaagaaaattctgcttttcctcgtcatctggaagctggcgatatagttcgagcagtctccgttcgtcggcctttaaaccgtccctctcgtcgacctcttggccaagaacccactcaagactcaccccaagcgcgtctgccagttttatcgccgagcttttcccaattgtaccgcgcacaaaccagttattgaccgactgagcactgaccccgcaaatgcgagccatgtccgacttggtcaactttttaagttcgaggatctcgttgagcctctgcacttgtgggtgattaatctgatgagttttttctttcataacacaattctaaaccaaaagtttattagctcaatattcaaaatgttgacattatgataaacattttgtttaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z