BBa_K374010 1 BBa_K374010 Gifsy1 anti-repressor which anti-represses the Gifsy1 repressor gogR from BBa_K374008 2010-10-19T11:00:00Z 2015-05-08T01:12:16Z Genomic sequence from the Salmonella phage Gifsy1 Gifsy1 is a temperate phage present many of the Salmonella enterica serovar Typhimurium strains. This part contains the anti-repressor from Gifsy1 called antO which inactivates the repressor from BB_K374008 resulting in transcription from the pR Gifsy1 promoter. AntO works by direct non-covalent binding to gogR and prevents its DNA binding activity. false false _520_ 0 7351 9 It's complicated false N/A false Lisa Blanc Iversen, Maya Friis Kjaergaard, Annemi Jollmann, Anja Sander and Grzegorz Slodkowicz BBa_K374010_sequence 1 atgaagggagaacaaaaattgagtaattcagctttgcaaaaatcagaagatagctggtatgacattgtaagaagatctgatggctgcgtagtgtttagctttccatcatcaggcaggcatcttatctatcgtgtaaatggcatggtatctatgcgtcctttgctggatgatgaagaagtttttactcccaacggttttatgcattttattcgccgtctcggctaccgggtaacaccaccttctgataatatgaaatcaacggcctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z