BBa_K374005 1 BBa_K374005 Lambda nutR site - N utilization site + Tr1 rho dependent terminator. 2010-10-16T11:00:00Z 2015-05-08T01:12:16Z nutR site from the lambda phage from E.coli. In lambda bacteriophage, gene expression is regulated by the suppression of transcription termination (antitermination) which is mediated by the lambda N protein that interacts with the nut site which is a cis-acting element [1]. This part contains the lambda nutR site which together with part (N part #) will suppress termination downstream regardless of what terminator is used. [1] Nudler, E. and Gottesman, M.E (2002). Transcription termination and anti-termination in E. coli. Genes to cells 7: 755-768. false false _520_ 0 6199 9 It's complicated false Requires a couple hundred base pairs upstream of the terminator. false Patrick Fortuna, Thomas Trolle, Anastasiya S. Haugaard, Martin Malthe Borch, Juliet Frederiksen annotation2088659 1 Rho utilization site A (rutA) range2088659 1 8 25 annotation2088702 1 Rho utilization site B (rutB) range2088702 1 41 60 annotation2088703 1 Rho dependant tR1 range2088703 1 77 101 annotation2088701 1 N utilization rightward range2088701 1 24 40 BBa_K374014 1 BBa_K374014 Lambda nutR site followed by BioBrick terminator BBa_B1003 2010-10-20T11:00:00Z 2015-05-08T01:12:17Z BioBrick ligation Lambda nutR site BBa_K374005 which has the a BioBrick terminator BBa_B1003 downstream of it. false false _520_ 0 6193 9 It's complicated false A medium terminator, in case the N protein can't antiterminate if the terminator is too strong. false Thomas Trolle, Anastasiya S. Haugaard, Juliet Frederiksen, Martin Malthe Borch, Patrick Fortuna component2091302 1 BBa_B1003 component2091297 1 BBa_K374005 annotation2091297 1 BBa_K374005 range2091297 1 1 118 annotation2091302 1 BBa_B1003 range2091302 1 127 160 BBa_B1003 1 BBa_B1003 Terminator (artificial, small, %T~=80) 2006-08-30T11:00:00Z 2015-08-31T04:07:21Z antiquity Released HQ 2013 Artifical terminator, estimated %T~=80 6bp stem, 4nt loop Bidirectional, estimated reverse %T=40 false false _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 5 residues. true Haiyao Huang annotation1898419 1 PolyA range1898419 1 26 30 annotation1898417 1 stem loop range1898417 1 10 25 annotation1898416 1 B1003 range1898416 1 1 34 annotation1898418 1 PolyA range1898418 1 5 9 BBa_K374014_sequence 1 ataaccccgctcttacacattccagccctgaaaaagggcatcaaattaaaccacacctatggtgtatgcatttatttgcatacattcaatcaattgttatctaaggaaatacttacattactagagcgccaaaaaccccgcttcggcggggtttttccgc BBa_B1003_sequence 1 cgccaaaaaccccgcttcggcggggtttttccgc BBa_K374005_sequence 1 ataaccccgctcttacacattccagccctgaaaaagggcatcaaattaaaccacacctatggtgtatgcatttatttgcatacattcaatcaattgttatctaaggaaatacttacat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z