BBa_K374012 1 BBa_K374012 FACS optimized GFP 2010-10-20T11:00:00Z 2015-05-08T01:12:17Z ? "FACS optimized mutant of the Green Flourescent Protein. The protein contains the following three mutations: S65A, V68L and S72A. Excitation maximum at 488 nm. For more information see US Patent 5,804,387. FACS-Optimized Mutants of The Green Flourescent Protein (GFP) filed by Cormack et al. Sep. 8th 1998. (GFPmut2)." false false _520_ 0 6193 9 Not in stock false None false Patrick Fortuna, Thomas Trolle, Anastasiya S. Haugaard, Martin Malthe Borch, Juliet Frederiksen BBa_K374005 1 BBa_K374005 Lambda nutR site - N utilization site + Tr1 rho dependent terminator. 2010-10-16T11:00:00Z 2015-05-08T01:12:16Z nutR site from the lambda phage from E.coli. In lambda bacteriophage, gene expression is regulated by the suppression of transcription termination (antitermination) which is mediated by the lambda N protein that interacts with the nut site which is a cis-acting element [1]. This part contains the lambda nutR site which together with part (N part #) will suppress termination downstream regardless of what terminator is used. [1] Nudler, E. and Gottesman, M.E (2002). Transcription termination and anti-termination in E. coli. Genes to cells 7: 755-768. false false _520_ 0 6199 9 It's complicated false Requires a couple hundred base pairs upstream of the terminator. false Patrick Fortuna, Thomas Trolle, Anastasiya S. Haugaard, Martin Malthe Borch, Juliet Frederiksen annotation2088701 1 N utilization rightward range2088701 1 24 40 annotation2088659 1 Rho utilization site A (rutA) range2088659 1 8 25 annotation2088703 1 Rho dependant tR1 range2088703 1 77 101 annotation2088702 1 Rho utilization site B (rutB) range2088702 1 41 60 BBa_K374016 1 BBa_K374016 GFP followed by lambda nutR 2010-10-20T11:00:00Z 2015-05-08T01:12:17Z BioBrick ligation GFP BBa_K374012 with BioBrick RBS BBa_B0034, followed by the lambda nutR site BBa_K374005. false false _520_ 0 6193 9 It's complicated false A part we created while building the constructs to test the N protein. false Thomas Trolle, Anastasiya S. Haugaard, Juliet Frederiksen, Martin Malthe Borch, Patrick Fortuna component2091316 1 BBa_B0034 component2091317 1 BBa_K374012 component2091322 1 BBa_K374005 annotation2091322 1 BBa_K374005 range2091322 1 741 858 annotation2091317 1 BBa_K374012 range2091317 1 19 732 annotation2091316 1 BBa_B0034 range2091316 1 1 12 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0034_sequence 1 aaagaggagaaa BBa_K374012_sequence 1 atgtctaaaggtgaagaactgtttacgggtgttgtgccgatcctggtggaactggatggtgatgtgaacggtcataaattctctgtgtctggtgaaggtgaaggtgatgcaacctacggtaagctgaccctgaaatttatctgtaccacgggtaaactgccggttccatggccgaccctggtgaccaccttcgcgtatggtctgcaatgctttgcgcgctacccggatcacatgaaacgtcacgactttttcaaatctgccatgccggaaggttatgtacaggaacgtaccatcttcttcaaagatgacggtaactacaaaacccgtgctgaagtgaaatttgaaggtgataccctggtgaaccgtatcgaactgaaaggtattgattttaaagaagatggtaacatcctgggccataaactggaatacaactacaactctcataacgtatacatcgtggcagacaaacagaaaaacggtatcaaagtgaacttcaaaatccgtcataacatcgaagatggttctgttcaactggcagaccattatcagcagaacaccccaattggcgatggcccggtgctgctgccggacaaccattacctgtccacgcagtctgccctttcgaaagatccgaacgaaaaacgtgaccacatggtgctgctggaatttgtgaccgctgccggcatcacgcatggcatgcatgagctgtataaa BBa_K374016_sequence 1 aaagaggagaaatactagatgtctaaaggtgaagaactgtttacgggtgttgtgccgatcctggtggaactggatggtgatgtgaacggtcataaattctctgtgtctggtgaaggtgaaggtgatgcaacctacggtaagctgaccctgaaatttatctgtaccacgggtaaactgccggttccatggccgaccctggtgaccaccttcgcgtatggtctgcaatgctttgcgcgctacccggatcacatgaaacgtcacgactttttcaaatctgccatgccggaaggttatgtacaggaacgtaccatcttcttcaaagatgacggtaactacaaaacccgtgctgaagtgaaatttgaaggtgataccctggtgaaccgtatcgaactgaaaggtattgattttaaagaagatggtaacatcctgggccataaactggaatacaactacaactctcataacgtatacatcgtggcagacaaacagaaaaacggtatcaaagtgaacttcaaaatccgtcataacatcgaagatggttctgttcaactggcagaccattatcagcagaacaccccaattggcgatggcccggtgctgctgccggacaaccattacctgtccacgcagtctgccctttcgaaagatccgaacgaaaaacgtgaccacatggtgctgctggaatttgtgaccgctgccggcatcacgcatggcatgcatgagctgtataaatactagagataaccccgctcttacacattccagccctgaaaaagggcatcaaattaaaccacacctatggtgtatgcatttatttgcatacattcaatcaattgttatctaaggaaatacttacat BBa_K374005_sequence 1 ataaccccgctcttacacattccagccctgaaaaagggcatcaaattaaaccacacctatggtgtatgcatttatttgcatacattcaatcaattgttatctaaggaaatacttacat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z