BBa_K374017 1 BBa_K374017 Gifsy2 anti-repressor which anti-represses the Gifsy2 repressor gtgR 2010-10-26T11:00:00Z 2015-05-08T01:12:17Z Genomic sequence from the Salmonella phage Gifsy2 Gifsy2 is a temperate phage present many of the Salmonella enterica serovar Typhimurium strains. This part contains the anti-repressor from Gifsy2 called antT which inactivates the repressor from BioBrick K_374009 resulting in transcription from the pR Gifsy2 promoter. AntT works by direct non-covalent binding to gtgR and prevents its DNA binding activity. false false _520_ 0 6200 9 Not in stock false N/A false Annemi Jollmann, Anja Sander, Maya Friis Kjaergaard, Lisa Blanc Iversen and Grzegorz Słodkowicz annotation2107493 1 Synthetic start codon range2107493 1 1 3 BBa_K374017_sequence 1 atggcagagggagtcctatcagatcttgctgataatttgcgggtgactataactgatgctaagggaatagaacttttgtcttttagacttgcatcaggtgatcgctatatcctatcaacccaaaacggttctgtaacaaaccgaaagctatcaagagatgatttgtactggtctaaggataccattatggaagttgtcagagagatgggctctaataattga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z