BBa_K376002 1 BBa_K376002 Anaerobic Promoter 2010-10-26T11:00:00Z 2015-05-08T01:12:17Z Synthetic This is an anaerobic promoter which uses the regulatory protein FNR to regulate its POPS output. false false _490_ 0 5013 400 Not in stock false constructed using oligo PCR assembly false Mike Kang BBa_K376002_sequence 1 gtattatttgatctttatcaaccgctaaaatatgcgttttgatcttcatcaataaaaacagcaacttcaatgtcttaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z