BBa_K376003 1 BBa_K376003 J6 Oxygen Sensitive Promoter 2010-10-25T11:00:00Z 2015-05-08T01:12:17Z Synthetic A composite promoter composed of FNR binding sites DcuC spacer region and the J23113 constitutive promoter. Activates transcription under micro-aerobic conditions. false false _490_ 0 5013 400 It's complicated true constructed using oligo assembly false Mike Kang BBa_K376003_sequence 1 tatattgataaagatcaaccgctaaatatgcgttttgatgaagatcaactgatggctagctcagtcctagggattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z