BBa_K380001 1 BBa_K380001 N-part TAT cell-penetrating peptide 2010-10-22T11:00:00Z 2015-05-08T01:12:17Z TAT is an 11-amino acid derivative from the Human Immunodeficiency Virus 1 (HIV-1) ''trans''-activating transcriptional activator (Tat) ([http://www.ncbi.nlm.nih.gov/pubmed/2849509 Green and Loewenstein, 1988]; [http://www.ncbi.nlm.nih.gov/pubmed/9846587 Nagahara ''et al.'' 1998). This part encodes the cell-penetrating peptide TAT and may be used in N-terminal fusions with full-length proteins to create transduction proteins with the ability to permeate the lipid bilayer of various cell types. Purified full-length TAT fusion proteins expressed in ''Escherichia coli'' have been shown to successfully translocate into several human cell types, including all cells found in whole blood, as well as bone marrow stem cells and osteoblasts, while still retaining the fused protein's activity ([http://www.ncbi.nlm.nih.gov/pubmed/9846587 Nagahara ''et al.'' 1998). The mechanism for transduction over the bilipid membrane is still a matter of debate, but has been suggested to occur by macropinocytosis, a specialized form of endocytosis. false false _491_ 0 6234 9 It's complicated true This part was designed from the amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids. false Johan Nordholm, Andreas Constantinou, Nina Schiller annotation2110019 1 Start codon range2110019 1 1 3 annotation2099170 1 TAT range2099170 1 1 36 BBa_K380001_sequence 1 atgtacggtcgtaagaagcgtcgccaacgccgtcgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z