BBa_K380002 1 BBa_K380002 LMWP cell-penetrating peptide 2010-10-24T11:00:00Z 2015-05-08T01:12:17Z LMWP is a 14-amino acid derivative from Rainbow trout (''Oncorhynchus mykiss'') protamine, an arginine-rich protein that replaces histones in chromatin during spermatogenesis ([http://www.ncbi.nlm.nih.gov/pubmed/3755398 McKay ''et al.'', 1986]; [http://www.ncbi.nlm.nih.gov/pubmed/10213181 Byun ''et al.'', 1999]). Low molecular weight protamine (LMWP) is a cell-penetrating peptide that may be used in N- and C-terminal fusions with full-length proteins to create transduction proteins with the ability to permeate the lipid bilayer of various cell types, making it a potential gene or protein delivery vector. Enzymatically prepared LMWP chemically conjugated to ovalbumin (OVA) and bovine serum albumin (BSA) have previously been shown to penetrate the lipid bilayer of human keratinocytes, as well as to successfully permeate mouse skin epidermis ([http://www.ncbi.nlm.nih.gov/pubmed/20232417 Huang ''et al.'', 2010]). Furthermore, LMWP/pDNA complexes can efficiently penetrate into human embryonic kidney cells ([http://www.ncbi.nlm.nih.gov/pubmed/12898639 Park ''et al.'', 2003]). As LMWP has been shown to be neither toxic nor immunogenic ([http://www.ncbi.nlm.nih.gov/pubmed/11741268 Chang ''et al.'' a, 2001]; [http://www.ncbi.nlm.nih.gov/pubmed/11741269 Chang ''et al.'' b, 2001]; [http://www.ncbi.nlm.nih.gov/pubmed/11741270 Lee ''et al.'', 2001]), it may be used as a potential vaccine, drug or gene delivery vector. ''This gene also exists as an N-part, [[Part:BBa_K380003]].'' false false _491_ 0 6234 9 It's complicated true This part was back translated from the amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids. false Johan Nordholm, Andreas Constantinou, Nina Schiller annotation2099237 1 LMWP range2099237 1 1 42 BBa_K380002_sequence 1 gtttctcgtcgccgccgtcgtcgcggtggacgtcgccgtcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z