BBa_K380005 1 BBa_K380005 N-part Tp10 cell-penetrating peptide 2010-10-24T11:00:00Z 2015-05-08T01:12:17Z Tp10 is a 21-amino acid derivative from the parent peptide transportan (originally known as galparan), which is a peptide chimera of the neuropeptide galanin and the wasp venom peptide mastoparan ([http://www.ncbi.nlm.nih.gov/pubmed/10930519 Soomets ''et al.'', 2000]; [http://www.ncbi.nlm.nih.gov/pubmed/8738882 Langel ''et al.'', 1996]). N-part Transportan 10 (Tp10) is a cell-penetrating that may be used in N-terminal fusions with full-length proteins to create transduction proteins with the ability to permeate the lipid bilayer of various cell types, making it a potential gene or protein delivery vector. Chemically synthesized Tp10 peptides conjugated to different cargo, including pDNA and protein, have been shown to efficiently penetrate the lipid bilayer of both human and mouse cells ([http://www.ncbi.nlm.nih.gov/pubmed/15763630 Kilk ''et al.'', 2005]). Membrane permeation is both energy and temperature independent ([http://www.ncbi.nlm.nih.gov/pubmed/11718666 Hällbrink ''et al.'', 2001]). The exact mechanism for penetration is still unclear ([http://www.ncbi.nlm.nih.gov/pubmed/17218466 Yandek ''et al.'', 2007]). '''For a version of Tp10 fusible also to protein C-termini, please see [[Part:BBa_K380004]].''' For more information on N-parts see the [http://partsregistry.org/Assembly_standard_25 Assembly Standard 25] information page. false false _491_ 0 6234 9 It's complicated true This part was back translated from the corresponding amino acid sequence and optimized for expression in ''Escherichia coli''. Codon usage has been varied for repetitive amino acids to enable DNA synthesis. false Johan Nordholm, Andreas Constantinou, Nina Schiller annotation2099676 1 Tp10 range2099676 1 1 66 annotation2109996 1 Start codon range2109996 1 1 3 BBa_K380005_sequence 1 atggcgggttacctgctgggtaagatcaacctgaaagcgctggcagcactggcgaagaagatcctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z