BBa_K380007 1 SOD1 Superoxide dismutase 1 protein 2010-10-24T11:00:00Z 2015-05-08T01:12:17Z Homo sapiens superoxide dismutase (SOD) mRNA, complete cds ([http://www.ncbi.nlm.nih.gov/nucleotide/38489879?report=genbank&log$=nucltop&blast_rank=22&RID=CAM83NYN01S GeneBank: AY450286.1]), 465 nucleotide gene. First reported by [http://www.ncbi.nlm.nih.gov/pubmed/3889846 Hallewell ??????et al??????., (1985)]. Superoxide dismutase 1 protein Human soluble superoxide dismutase 1(SOD1), complete cds (GenBank: AY450286.1). SOD1 is a soluble cytoplasmic protein functional as a homodimer that binds copper and zink ions. SOD1 catalyzes the reaction O<sup>-</sup><sub>2</sub> + O<sup>-</sup><sub>2</sub> + 2H<sup>+</sup> &rarr; H<sub>2</sub>O<sub>2</sub> + O<sub>2</sub>, protecting the cell from oxidative damage. SOD1 was first cloned and expressed in E. coli by [http://www.ncbi.nlm.nih.gov/pubmed/3889846 Hallewell ??????et al??????., (1985)]. Co-expression of SOD1 with the yeast copper chaperon (yCCS) ([http://www.ncbi.nlm.nih.gov/pubmed/15358352 Ahl ??????et al??????. 2003]) yields proteins with higher copper contents, leading to increased activity and more stable proteins. For the helper yeast copper chaperone (yCCS), see [[Part:BBa_K380008]]. false false _491_ 0 7388 9 It's complicated false The start and stop codon was removed and the gene was redesigned with BioBrick prefix and suffix according to assembly standard 25 using specifically designed primers and PCR false Andreas Constantinou, Emmelie Lidh, Nina Schiller, Johan Nordholm annotation2098172 1 s_d_mut range2098172 1 302 302 annotation2098171 1 superoxide dismutase range2098171 1 1 459 BBa_K380007_sequence 1 gcgacgaaggccgtggccgtgctgaagggcgacggcccagtgcagggcatcatcaatttcgagcagaaggaaagtaatggaccagtgaaggtgtggggaagcattaaaggactgactgaaggcctgcatggattccatgttcatgagtttggagataatacagcaggctgtaccagtgcaggtcctcactttaatcctctatccagaaaacacggtgggccaaaggatgaagagaggcatgttggagacttgggcaatgtgactgctgacaaagatggtgtggccgatgtgtctattgaaggttctgtgatctcactctcaggagaccatgccatcattggccgcacactggtggtccatgaaaaagcagatgacttgggcaaaggtggaaatgaagaaagtacaaagacaggaaacgctggaagtcgtttggcttgtggtgtaattgggatcgcccaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z