BBa_K380008 1 yCCS Yeast copper chaperon protein 2010-10-24T11:00:00Z 2015-05-08T01:12:17Z Saccharomyces cerevisiae S288c Ccs1p (CCS1), mRNA ([http://www.ncbi.nlm.nih.gov/nuccore/NM_001182535.1?report=genbank&log$=seqview GeneBank: NM_001182535.1]), 750 nucleotide gene. First identified and characterized by [http://www.ncbi.nlm.nih.gov/pubmed/9295278 Culotta ??????et al??????. (1997)]. Yeast copper chaperon protein (yCCS) is a help chaperon specific for copper/zinc superoxide dismutase located to the cytoplasm. yCCS has been shown to successfully mediate the delivery of copper ions to human superoxide dismutase 1 (SOD1) ([http://www.ncbi.nlm.nih.gov/pubmed/15358352 Ahl ??????et al??????. 2003]). yCCS generates fully metallized, active SOD1 proteins that in turn protects the cell from oxidative damage. For the human superoxide dismutase 1 (SOD1), see [[Part:BBa_K380007]]. false false _491_ 0 7388 9 It's complicated false The start and stop codon was removed and the gene was redesigned with BioBrick prefix and suffix according to assembly standard 25 using specifically designed primers and PCR. A restriction site for EcoRI at basepair number 228 was removed using site-directed mutagenesis PCR false Andreas Constantinou, Emmelie Lidh, Nina Schiller, Johan Nordholm annotation2098220 1 s_d_mut range2098220 1 257 257 annotation2098219 1 yeast copper chaperon for SOD range2098219 1 1 744 BBa_K380008_sequence 1 accacgaacgatacatacgaggctacttatgccattcccatgcactgtgaaaattgcgtgaatgatataaaggcgtgcctaaaaaatgtcccaggaatcaattcattgaatttcgatatagagcaacaaataatgagcgtggaaagctcagtagccccttcaactatcatcaacaccttgcgaaactgcggtaaagacgccatcataagaggcgccgggaagccgaactcttccgcggtcgctatcttagagacctttcaaaaatatactatagaccagaaaaaggacaccgccgtgaggggcctagcaagaatcgttcaggttggagagaataagactctttttgacatcactgtaaatggcgtcccagaggcgggaaattaccacgccagcattcacgagaaaggcgacgtctccaagggcgtggaatctactggtaaagtttggcacaagttcgacgaacccattgaatgcttcaacgagagtgatttgggcaagaacttgtacagtgggaagacctttctgagcgctcccttgccaacatggcaacttatcggccgcagctttgtcatttccaagtctctgaaccacccagaaaacgagccttcctccgttaaggactactcatttctgggagtcattgcgagaagcgctggtgtgtgggaaaataataaacaagtgtgtgcgtgtaccggaaagactgtttgggaagagagaaaagatgccttggccaacaacatcaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z