BBa_K382020 1 BBa_K382020 Arabidopsis optimized Brazzein 2010-10-25T11:00:00Z 2015-05-27T01:42:05Z Synthesis was performed by Mr. Gene, optimized for Arabidopsis expression. Based on Genbank sequence ACK76425.1. Brazzein is a sweet-tasting protein that is found in the Western African fruit, the Oubli (Pentadiplandra brazzeana). The protein consists of a 54 amino acid sequence. It is sweeter than sugar and is used as an alternative low calorie sweetener. false false _488_ 4206 7814 9 It's complicated true N/A false Patrick Boyle annotation2113975 1 start codon range2113975 1 1 3 annotation2113977 1 open reading frame (no stop codon) range2113977 1 1 165 BBa_K382020_sequence 1 atgcaagataagtgtaaaaaagtgtatgagaactatcctgtgagtaaatgccaattggcaaaccagtgcaattatgattgtaaactcgataagcacgctaggagtggagagtgtttctatgatgagaagaggaacctccagtgtatctgtgattattgtgagtat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z