BBa_K385002 1 BBa_K385002 Phage MS2 coat protein 2010-09-21T11:00:00Z 2015-05-08T01:12:18Z Phage MS2 genome (see NCBI sequence http://www.ncbi.nlm.nih.gov/nuccore/V00642.1) This sequence encodes the MS2 coat protein from phage MS2 (R17). It has the property of being able to bind RNA stem loops in a sequence-specific manner. The sequence of the MS2 stem loops is provided in part number BBa_K385000. The coding sequence is supplied without a stop codon, so that it can be used as part of an N-terminal fusion. false false _501_ 0 3969 9 It's complicated true We omitted the stop codon so this part could be used in a protein fusion construct, with the MS2 protein forming the N-terminal domain false Krystal Annand, Joseph Hoare, Justyna Kucia, Stephen Lam BBa_K385002_sequence 1 atggcttctaactttactcagttcgttctcgtcgacaatggcggaactggcgacgtgactgtcgccccaagcaacttcgctaacggggtcgctgaatggatcagctctaactcgcgttcacaggcttacaaagtaacctgtagcgttcgtcagagctctgcgcagaatcgcaaatacaccatcaaagtcgaggtgcctaaagtggcaacccagactgttggtggagtagagcttcctgtagccgcatggcgttcgtacttaaatatggaactaaccattccaattttcgctactaattccgactgcgagcttattgttaaggcaatgcaaggtctcctaaaagatggaaacccgattccctcagcaatcgcagcaaactccggcatctacggtgacggtgctggtttaattaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z