BBa_K385004 1 BBa_K385004 Phage lambda N-peptide, tandem repeat 2010-09-26T11:00:00Z 2015-05-08T01:12:18Z Phage lambda genome Two copies of the N-peptide from phage lambda, arranged as a tandem repeat. The N-peptide protein coding sequence functions in a phage transcriptional termination control mechanism, by binding to an RNA stem loop (B-box) in a sequence specific manner. This peptide can be used as part of a translational control strategy for eukaryote gene expression. The B-box sequence should be placed in the 5' leader of a gene whose expression is to be controlled, and the N-peptide is expressed in trans to regulate ribosomal scanning. Tandem repeats of the N-peptide were cloned in this BioBrick so as to optimise binding opportunities to the target mRNA stem loop. false false _501_ 0 3969 9 It's complicated true The part was engineered with an AUG, but no stop codon, to allow the part to be used as a translational fusion with another downstream open reading frame. A glycine rich spacer peptide was inserted at the 3' end of each of the tandem N-peptide repeats, to allow the N-peptide to be separated from each other, and any downstream ORF by a flexible linker. (Linker sequence GGT GAC GGT GCT GGT TTA ATT AAC) false Krystal Annand, Joseph Hoare, Stephen Lam, Justyna Kucia BBa_K385004_sequence 1 atggatgctcaaactagaagaagagaaagaagagctgaaaaacaagctcaatggaaagctgctaatggtgacggtgctggtttaattaacgacgctcaaacccgtagaagagagagaagagccgaaaagcaagctcaatggaaggccgctaacggtgatggcgccggcttgattaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z