BBa_K385005 1 BBa_K385005 B-box sequence encoding a regulatory mRNA stem loop 2010-09-26T11:00:00Z 2015-05-08T01:12:18Z Phage lambda genome This part encodes a sequence that is capable of forming a stem loop in the mRNA. Moreover, this stem loop is bound in a sequence and structure-specific manner by the N-peptide sequence (see part numbers BBa_K385003 and BBa_K385004). The mRNA stem sequence is derived from phage lambda, and forms part of a transcriptional termination attenuation system. This stem loop encoding sequence can be used as part of a eukaryote gene expression control strategy. Insertion of this stem loop into the 5' untranslated region (5'UTR) of a target gene (i.e. between the transcript start site and the AUG translation initiation site) will allow this mRNA to be actively translated in the absence of the N-peptide sequence. However, expression of the N-peptide in trans will allow N-peptide binding to the B-box stem, causing translational attenuation by inhibition of ribosome scanning along the 5'UTR. false false _501_ 0 3969 9 It's complicated true The sequence forms part of a 5' untranslated leader, and so must be free from all AUG sequences. false Stephen Lam, Justyna Kucia, Joseph Hoare, Krystal Annand BBa_K385005_sequence 1 attatctacttaagggccctgaagaagggcccttaagaacacaaaattcgagacat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z