BBa_K386002 1 BBa_K386002 HapR promoter 2010-10-24T11:00:00Z 2015-05-08T01:12:18Z The sequence of this part comes from the cholera genome data base. This part contains the promoter for HapR. HapR is a downstream product of the CqsS pathway found in the cholera quorum sensing system. HapR acts to inhibit virulence genes in cholera when there is a high cell density. false false _500_ 0 7173 9 Not in stock false The part contains the iGEM prefix and suffix. false Matthew Ford BBa_K386002_sequence 1 accagttgaaaaagaatgcattgtataaatggggcttggagaatttaggcgaataattttctcttctatccatttcctacttgaagctgtagcggtgttggcagaatttgctcaccccaatcacagagtgtatct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z