BBa_K387011 1 BBa_K387011 MEF2-JeT promoter 2010-10-14T11:00:00Z 2015-05-08T01:12:18Z This promoter is synthesized de novo using DNA synthesis techniques. This promoter is an alignment of MEF2 enhancer and JeT core promoter in Eukaryotes, and is used in sensing the calcium signal. MEF2 enhancer element is the binding site of transcription factor MEF2c， which recruits Cabin1 and HDAC (Histone deacetylase) and blocks transcription. The influx of Ca2+ can activates this promoter because calcium and calmodulin could dissociate Cabin1 while p300 HAT (Histone acetyltransferase) competes with Cabin1 for binding to MEF2. (Hong-Duk Youn and Jun O. Liu, 2000) JeT promoter is a synthetic core promoter which recruits basal transcription machinery. Alignment with enhancer element will up or down regulate the activity of this promoter. (Jens Torn??e, Philip Kusk, Teit E. Johansen et al., 2002) false false _499_ 0 5169 9 It's complicated true We invited a BGH polyA sequence in the front of this promoter to attenuate the influence of constitutive promoters in other commercial vectors (because this promoter should be inserted into shuttle plasmids or virus plasmids). false Han Zhu annotation2086204 1 JeT core promoter range2086204 1 300 485 annotation2086202 1 BGH polyA range2086202 1 1 224 annotation2086203 1 MEF2 enhancer range2086203 1 225 299 BBa_K387011_sequence 1 ctgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatacggtgggctctatggggatctctggaagctactatatttagccggcgcagcgggcgagaggaaaactatttatagatcaaacaatggatctgggcggagttagggcggagccaatcagcgtgcgccgttccgaaagttgccttttatggctgggcggaagcttagaatgggcggtgaacgccgatgattatataaggacgcgccgggtgtggcacagctagttccgtcgcagccgggatttgggtcgcggttcttgtttgtggatcctaactcgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z