BBa_K387012 1 BBa_K387012 CRE-JeT promoter 2010-10-14T11:00:00Z 2015-05-08T01:12:18Z This promoter is synthesized de novo using DNA synthesis techniques This part is an alignment of CRE (cAMP response element) enhancer and JeT core promoter which is sensitive to calcium signals in eukaryotic cells. CRE is the binding site of CRE-BP transcription factor family and JeT promoter is a synthetic core promoter which recruits basal transcription machinery. false false _499_ 0 5169 9 It's complicated true We invited a BGH polyA sequence in the front of this promoter to attenuate the influence of constitutive promoters in other commercial vectors (because this promoter should be inserted into shuttle plasmids or virus plasmids). false Han Zhu annotation2086213 1 JeT range2086213 1 303 600 annotation2086212 1 CRE enhancer range2086212 1 225 302 annotation2086211 1 BGH polyA range2086211 1 1 224 BBa_K387012_sequence 1 ctgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggggatctacccggttagtgacgtcagtacacaagcacatagttgcgcaggcctacgtgacgttatagacacacgggatctgggcggagttagggcggagccaatcagcgtgcgccgttccgaaagttgccttttatggctgggcggaagcttagaatgggcggtgaacgccgatgattatataaggacgcgccgggtgtggcacagctagttccgtcgcagccgggatttgggtcgcggttcttgattgtggatctcaactcgagcatgcatctagagggccctattctatagtgtcacctaaatgctagagctcgctgatcaccctctactgtgtcttctaaatgtcagccatcttgttgtttgccttccccccg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z