BBa_K389003 1 Pvir virB promoter 2010-08-09T11:00:00Z 2015-05-08T01:12:19Z ''A. tumefaciens'' C58, TI-plasmid This is a ''vir'' promotor from ''Agrobacterium tumefaciens'' C58. It is located on the TI-plasmid before the ''virB'' genes. It is activated by phosphorylated ''virG'' response regulator. false false _517_ 0 6670 9 It's complicated false contains already a RBS false Jonas Aretz annotation2077851 1 -10 range2077851 1 113 117 annotation2077848 1 vir-box range2077848 1 33 44 annotation2077849 1 rbs range2077849 1 153 157 annotation2077850 1 -35 range2077850 1 89 93 BBa_K389003_sequence 1 gcacccttaagtgcatggaaagccgttttcgcttcaaatgaaatcgaaaagaagaaaacaaaaatcctagagtaaccgaccctcccgataatcgtgaacatcagatgacagcatttcttccgaccgaagtggctgtgttggttatgagcttgaggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z