BBa_K390002 1 BBa_K390002 5'UTR and consensus RBS from psbA2 in Synechocystis sp. PCC 6803 2010-07-31T11:00:00Z 2015-05-08T01:12:19Z Based on genomic sequence in Synechocystis sp. PCC 6803. Made from annealing of two oligionucleotides that contained the mutations to the consensus RBS. This is the 5'UTR and RBS region from gene psbA2 in Synechocystis sp. PCC 6803. It covers the entire region from the end of the promoter (as reported in Imamura S and Asayama M. 2009. Sigma Factors for Cyanobacterial Transcription. Gene Regulation and Systems Biology 3: 65-87) to immediately before the start codon of the psbA2 gene. The RBS region has been mutated from the native RBS "taaggaatta" to the consensus RBS "aaaggaggtt" for Synechocystis sp. PCC 6803. This part can serve as a general RBS for Synechocystis sp. PCC 6803, until a library of RBS strengths in PCC 6803 is assembled. The consensus RBS was determined by aligning the 9 nucleotides on the 3' end sequence of the 16S rRNA to the 20 nucleotides preceding the start codon of every gene in PCC 6803. The most frequently represented nucleotide at each location along the alignment was considered to be the consensus. (Note: the alignment was done in relation to the 16S rRNA sequence, and not the start codon, as the spacing between RBS and the start codon varied considerably from gene to gene). false false _518_ 0 6788 9 It's complicated false none false Cody Tramp annotation2076289 1 t > a range2076289 1 33 33 annotation2076291 1 a > t range2076291 1 42 42 annotation2076290 1 at > gg range2076290 1 39 40 annotation2076212 1 consensus RBS range2076212 1 33 42 annotation2076211 1 5' UTR with consensus RBS range2076211 1 1 49 annotation2076269 1 SDS core consensus range2076269 1 35 40 BBa_K390002_sequence 1 agtcagttccaatctgaacatcgacaaatacaaaaggaggtttaaccaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z