BBa_K390003 1 BBa_K390003 pilA secretion tag for Synechocystis sp. PCC 6803 2010-07-31T11:00:00Z 2015-05-08T01:12:19Z Based on genomic sequence. Part was created by annealing two oligionucleotides together. This is the secretion tag on the 5' end of the coding sequence of the ''pil''A gene in ''Synechocystis'' sp. PCC 6803. The PilA protein is the major secreted protein in this species (Sergeyenko TV and Los D A. 2000. Identification of secreted proteins of the cyanobacterium ''Synechocystis'' sp. strain PCC 6803. FEMS Microbiology Letters 193: 213-216). In ''Synechocystis'' sp. PCC 6803, the system of secretion is based on the charge of the N-terminus leader sequence. Positive charges on the N-terminus leader sequence contribute to secretion in a non-sequence-dependent manner (Sergeyenko TV and Los DA. 2003. Cyanobacterial leader peptides for protein secretion. FEMS Microbiology Letters 218: 351-357). false false _518_ 0 6788 9 It's complicated false none false Cody Tramp annotation2076213 1 Start Codon range2076213 1 1 3 annotation2076214 1 secretion tag - Synechocystis sp. PCC 6803 range2076214 1 1 64 BBa_K390003_sequence 1 atggctagtaattttaaattcaaactcctctctcaactctccaaaaaacgggcagaaggtggta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z