BBa_K390005 1 BBa_K390005 psbA2 Type I promoter from Synechocystis sp. PCC 6803 2010-07-31T11:00:00Z 2015-05-08T01:12:19Z Synechocystis genomic sequence, part made by anneal two oligionucleotides together. Promoter of the ''psb''A2 gene, which is a reaction center protein of photosystem II in ''Synechocystis'' sp. PCC 6803. This is a Type 1 promoter and is recognized by the sigma factor SigD. It may potentially be a light-induced promoter (Imamura S and Asayama M. 2009. Sigma Factors for Cyanobacterial Transcription. Gene Regulation and Systems Biology 3:65-87). false false _518_ 0 6788 9 It's complicated false none false Cody Tramp annotation2076275 1 -35 box range2076275 1 3 8 annotation2076276 1 psbA2 promoter range2076276 1 1 38 annotation2076277 1 -10 box range2076277 1 27 32 BBa_K390005_sequence 1 gctttacaaaactctcattaatcctttagactaagttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z