BBa_K390006 1 BBa_K390006 sigA Type I promoter from Synechocystis sp. PCC 6803 2010-07-31T11:00:00Z 2015-05-08T01:12:19Z Sequence for genomic DNA, part assembled by annealing of two oligionucleotides. This is the promoter for the sigma factor ''sig''A in ''Synechocystis'' sp. PCC 6803. It is self-regulating (controlled by SigA), but has shown to potentially be down-regulated due to changes from heat-shock, darkness, and salt stress. A decrease in SigA protein was observed in a SigC knockout, but not direct proportion to the transcript of SigA (Imamura S and Asayama M. 2009. Sigma Factors for Cyanobacterial Transcription. Gene Regulation and Systems Biology 3:65-87). As SigA is the housekeeping sigma factor for ''Synechocystis'' sp. PCC 6803, this promoter is likely constitutive, with a moderate level of expression (this is pending experimental verification). false false _518_ 0 6788 9 It's complicated false none false Cody Tramp annotation2076278 1 sigA promoter range2076278 1 1 42 annotation2076280 1 -10 box range2076280 1 27 32 annotation2076279 1 -35 box range2076279 1 6 11 BBa_K390006_sequence 1 caactttgactgaccagctaattttgtacacgacttaggagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z