BBa_K390007 1 BBa_K390007 sigE Type II promoter from Synechocystis sp. PCC 6803 2010-07-31T11:00:00Z 2015-05-08T01:12:19Z Source was Genomic sequence, but part was constructed by annealing two oligionucleotides together. This is the promoter of the ''sig''E sigma factor gene in ''Synechocystis'' sp. PCC 6803. This sigma factor has been observed to respond to circadian rhythm in PCC 6803, with increased expression during light exposure, and decreased expression in the dark. It also possesses a binding site for NctA, a nitrogen stress responsive regulatory protein, suggesting that it may also be nitrogen responsive. (Imamura S, and Asayama M. 2009. Sigma Factors for Cyanobacterial Transcription. Gene Regulation and Systems Biology 3:65-87) false false _518_ 0 6788 9 It's complicated false none false Cody Tramp annotation2076281 1 sigE promoter range2076281 1 1 46 annotation2076282 1 NctA enhancer binding site range2076282 1 1 14 annotation2076283 1 -10 box range2076283 1 36 41 BBa_K390007_sequence 1 gtatcacgaattacactgccgtgaaaatttaacgatattttggaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z