BBa_K390008 1 BBa_K390008 lrtA Type II promoter from Synechocystis sp. PCC 6803 2010-07-31T11:00:00Z 2015-05-08T01:12:19Z Source was genomic sequence, but was assembled by annealing two oligonucleotides together. This is the promoter for the ''lrt''A gene from ''Synechocystis'' sp. PCC 6803. It has been observed to increase expression during darkness, making it a potential dark-responsive promoter (Imamura S, and Asayama M. 2009. Sigma Factors for Cyanobacterial Transcription. Gene Regulation and Systems Biology 3:65-87). false false _518_ 0 6788 9 It's complicated false none false Cody Tramp annotation2076285 1 -10 box range2076285 1 27 32 annotation2076284 1 lrtA promoter range2076284 1 1 38 BBa_K390008_sequence 1 attaggtcttattcaatacatagtgctaatctgaagat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z