BBa_K390009 1 BBa_K390009 sigF Type III promoter from Synechocystis sp. PCC 6803 2010-07-31T11:00:00Z 2015-05-08T01:12:19Z Source was genomic sequence, but was constructed by annealing two oligonucleotides together. This is the promoter for the ''sig''F sigma factor in ''Synechocystis'' sp. PCC 6803. It is self-regulated by the SigF protein. The protein is present at levels below detectable limits, but is still present in enough quantity to control type III promoter expression (Imamura S, and Asayama M. 2009. Sigma Factors for Cyanobacterial Transcription. Gene Regulation and Systems Biology 3:65-87). This could potentially be a low-level constitutive promoter. false false _518_ 0 6788 9 It's complicated false none false Cody Tramp annotation2076287 1 -32 box range2076287 1 6 10 annotation2076286 1 sigF promoter range2076286 1 1 37 annotation2076288 1 -10 box range2076288 1 25 29 BBa_K390009_sequence 1 tgatgtaggcagagtccaaccatcggtaaagttgatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z