BBa_K390010 1 BBa_K390010 hspA Type I Promoter from Synechocystis sp. PCC 6803 2010-07-31T11:00:00Z 2015-05-08T01:12:19Z Source was genomic sequence, but was assembled by annealing two olgionucleotides together. This is the promoter for the ''hsp''A ("heat shock protein A") gene in ''Synechocystis'' sp. PCC 6803. This gene is upregulated under heat stress conditions (preferred growth temperature of PCC 6803 is 30 degrees C, and heat stress occurs around 45 degrees C). It was suggested that it is recognized by SigB and SigA (Imamura S, and Asayama M. 2009. Sigma Factors for Cyanobacterial Transcription. Gene Regulation and Systems Biology 3:65-87). false false _518_ 0 6788 9 It's complicated false none false Cody Tramp annotation2076293 1 hspA promoter range2076293 1 1 38 annotation2076294 1 -10 box range2076294 1 27 32 annotation2076292 1 -35 box range2076292 1 6 11 BBa_K390010_sequence 1 cgaatctaacctggaaggggaaattttaagatagaacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z