BBa_K390011 1 BBa_K390011 glnBP2 Type II promoter from Synechocystis sp. PCC 6803 2010-07-31T11:00:00Z 2015-05-08T01:12:19Z Source is genomic sequence, but was assembled by annealing two oligonucleotides together. This is the promoter for the ''gln''BP2 gene in ''Synechocystis'' sp. PCC 6803. It has a NctA enhancer binding site, and thus is responsive to nitrogen stress. It encodes the PII protein, a conserved nitrogen status sensing protein that is conserved among bacteria, archea, and plants, which also may play a role in regulating carbon-nitrogen balance (Imamura S, and Asayama M. 2009. Sigma Factors for Cyanobacterial Transcription. Gene Regulation and Systems Biology 3:65-87). false false _518_ 0 6788 9 It's complicated false none false Cody Tramp annotation2076296 1 NctA binding site range2076296 1 1 14 annotation2076295 1 glnBP2 promoter range2076295 1 1 48 annotation2076297 1 -10 box range2076297 1 38 43 BBa_K390011_sequence 1 gtactgatttttacaaaaaaacttttggaggacatgttaaaagtgtct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z