BBa_K390012 1 BBa_K390012 pilA1 Type III promoter from Synechocystis sp. PCC 6803 2010-07-31T11:00:00Z 2015-05-08T01:12:19Z Source was genomic sequence, but was assembled by annealing two oligonucleotides together. This is the promoter for the ''pil''A1 gene in ''Synechocystis'' sp. PCC 6803. The PilA protein is the major secreted protein in PCC 6803, and its expression is controlled by SigF (Imamura S, and Asayama M. 2009. Sigma Factors for Cyanobacterial Transcription. Gene Regulation and Systems Biology 3:65-87). false false _518_ 0 6788 9 It's complicated false none false Cody Tramp annotation2076298 1 -32 box range2076298 1 5 9 annotation2076300 1 pilA1 promoter range2076300 1 1 37 annotation2076299 1 -10 box range2076299 1 24 28 BBa_K390012_sequence 1 gtgataggcaaatgagggcgatgggtaagttacagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z