BBa_K390001 1 BBa_K390001 5'UTR and native RBS from psbA2 in Synechocystis sp. PCC 6803 2010-07-31T11:00:00Z 2015-05-08T01:12:19Z Genomic sequences from Synechocystis sp. PCC 6803 This is the 5'UTR and RBS region from gene psbA2 in Synechocystis sp. PCC 6803. It covers the entire region from the end of the promoter (as reported in Imamura S and Asayama M. 2009. Sigma Factors for Cyanobacterial Transcription. Gene Regulation and Systems Biology 3: 65-87) to immediately before the start codon of the psbA2 gene. This part can serve as a general RBS for Synechocystis sp. PCC 6803, until a library of RBS strengths in PCC 6803 is assembled. The psbA2 gene codes for the photosystem II D1 protein in this species, and therefore we assume (and plan to verify) that the RBS strength is moderate to strong, due to the high requirement for this protein in photosynthesis. false false _518_ 0 6788 9 It's complicated false We decided to go with the full region from the promoter to the start codon. This means that, with the addition of the biobrick scar, the RBS may be located farther from the start codon then is optimal. We plan to determine optimum spacing of the RBS in Synechocystis sp. PCC 6803 in future work. false Cody Tramp annotation2076273 1 SDS core consensus range2076273 1 35 38 annotation2076272 1 5' UTR with native RBS range2076272 1 1 49 annotation2076274 1 native RBS range2076274 1 33 42 BBa_K390028 1 BBa_K390028 GFP with 5'UTR and native RBS from Synechocystis sp. PCC 6803 2010-07-31T11:00:00Z 2015-05-08T01:12:19Z composite part This part is the cycle 3 mutant GFP (BBa_K208000) with the Synechocystis 5'UTR and native RBS. It will be preceded by a series of promoters to assess their expression levels and conditions of activation. false false _518_ 0 6788 9 It's complicated false none false Cody Tramp component2076225 1 BBa_K390001 component2076228 1 BBa_K208000 annotation2076228 1 BBa_K208000 range2076228 1 56 775 annotation2076225 1 BBa_K390001 range2076225 1 1 49 BBa_K208000 1 BBa_K208000 GFP 2009-10-07T11:00:00Z 2015-05-08T01:11:24Z plasmid GFP false false _310_ 0 2425 303 It's complicated true Mutate PstI sites false Elisabeth Linton annotation2062216 1 Start range2062216 1 1 3 annotation2062217 1 GFP Coding Region range2062217 1 1 720 BBa_K390001_sequence 1 agtcagttccaatctgaacatcgacaaatacataaggaattataaccaa BBa_K208000_sequence 1 atggctagcaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgctacatacggaaagcttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactcgagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggatccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgccctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataa BBa_K390028_sequence 1 agtcagttccaatctgaacatcgacaaatacataaggaattataaccaatactagatggctagcaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgctacatacggaaagcttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactcgagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggatccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgccctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z