BBa_K390002 1 BBa_K390002 5'UTR and consensus RBS from psbA2 in Synechocystis sp. PCC 6803 2010-07-31T11:00:00Z 2015-05-08T01:12:19Z Based on genomic sequence in Synechocystis sp. PCC 6803. Made from annealing of two oligionucleotides that contained the mutations to the consensus RBS. This is the 5'UTR and RBS region from gene psbA2 in Synechocystis sp. PCC 6803. It covers the entire region from the end of the promoter (as reported in Imamura S and Asayama M. 2009. Sigma Factors for Cyanobacterial Transcription. Gene Regulation and Systems Biology 3: 65-87) to immediately before the start codon of the psbA2 gene. The RBS region has been mutated from the native RBS "taaggaatta" to the consensus RBS "aaaggaggtt" for Synechocystis sp. PCC 6803. This part can serve as a general RBS for Synechocystis sp. PCC 6803, until a library of RBS strengths in PCC 6803 is assembled. The consensus RBS was determined by aligning the 9 nucleotides on the 3' end sequence of the 16S rRNA to the 20 nucleotides preceding the start codon of every gene in PCC 6803. The most frequently represented nucleotide at each location along the alignment was considered to be the consensus. (Note: the alignment was done in relation to the 16S rRNA sequence, and not the start codon, as the spacing between RBS and the start codon varied considerably from gene to gene). false false _518_ 0 6788 9 It's complicated false none false Cody Tramp annotation2076289 1 t > a range2076289 1 33 33 annotation2076211 1 5' UTR with consensus RBS range2076211 1 1 49 annotation2076212 1 consensus RBS range2076212 1 33 42 annotation2076269 1 SDS core consensus range2076269 1 35 40 annotation2076290 1 at > gg range2076290 1 39 40 annotation2076291 1 a > t range2076291 1 42 42 BBa_K390029 1 BBa_K390029 GFP with 5'UTR and consensus RBS from Synechocystis sp. PCC 6803 2010-07-31T11:00:00Z 2015-05-08T01:12:19Z composite part This part is the cycle 3 mutant GFP (BBa_K208000) with the Synechocystis 5'UTR and consensus RBS (BBa_K390002). It will be preceded by a series of promoters to assess their expression levels and conditions of activation. It will also be used to determine if expression levels on those promoters differs depending on the sequence of the RBS. false false _518_ 0 6788 9 It's complicated false none false Cody Tramp component2076231 1 BBa_K390002 component2076234 1 BBa_K208000 annotation2076231 1 BBa_K390002 range2076231 1 1 49 annotation2076234 1 BBa_K208000 range2076234 1 56 775 BBa_K208000 1 BBa_K208000 GFP 2009-10-07T11:00:00Z 2015-05-08T01:11:24Z plasmid GFP false false _310_ 0 2425 303 It's complicated true Mutate PstI sites false Elisabeth Linton annotation2062216 1 Start range2062216 1 1 3 annotation2062217 1 GFP Coding Region range2062217 1 1 720 BBa_K390002_sequence 1 agtcagttccaatctgaacatcgacaaatacaaaaggaggtttaaccaa BBa_K390029_sequence 1 agtcagttccaatctgaacatcgacaaatacaaaaggaggtttaaccaatactagatggctagcaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgctacatacggaaagcttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactcgagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggatccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgccctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataa BBa_K208000_sequence 1 atggctagcaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgctacatacggaaagcttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactcgagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggatccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgccctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z