BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K208014 1 BBa_K208014 GFP (Silver Fusion)/Double Terminator 2009-10-19T11:00:00Z 2015-05-08T01:11:24Z Composite of GFP with BioBrick Terminator GFP with Terminator false true _310_ 0 3473 9 It's complicated false Silver Fusion false USU iGEM 2009 component2056813 1 BBa_B0012 component2056811 1 BBa_B0010 component2056810 1 BBa_K208000 annotation2056813 1 BBa_B0012 range2056813 1 817 857 annotation2056811 1 BBa_B0010 range2056811 1 729 808 annotation2056810 1 BBa_K208000 range2056810 1 1 720 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_K390002 1 BBa_K390002 5'UTR and consensus RBS from psbA2 in Synechocystis sp. PCC 6803 2010-07-31T11:00:00Z 2015-05-08T01:12:19Z Based on genomic sequence in Synechocystis sp. PCC 6803. Made from annealing of two oligionucleotides that contained the mutations to the consensus RBS. This is the 5'UTR and RBS region from gene psbA2 in Synechocystis sp. PCC 6803. It covers the entire region from the end of the promoter (as reported in Imamura S and Asayama M. 2009. Sigma Factors for Cyanobacterial Transcription. Gene Regulation and Systems Biology 3: 65-87) to immediately before the start codon of the psbA2 gene. The RBS region has been mutated from the native RBS "taaggaatta" to the consensus RBS "aaaggaggtt" for Synechocystis sp. PCC 6803. This part can serve as a general RBS for Synechocystis sp. PCC 6803, until a library of RBS strengths in PCC 6803 is assembled. The consensus RBS was determined by aligning the 9 nucleotides on the 3' end sequence of the 16S rRNA to the 20 nucleotides preceding the start codon of every gene in PCC 6803. The most frequently represented nucleotide at each location along the alignment was considered to be the consensus. (Note: the alignment was done in relation to the 16S rRNA sequence, and not the start codon, as the spacing between RBS and the start codon varied considerably from gene to gene). false false _518_ 0 6788 9 It's complicated false none false Cody Tramp annotation2076211 1 5' UTR with consensus RBS range2076211 1 1 49 annotation2076289 1 t > a range2076289 1 33 33 annotation2076212 1 consensus RBS range2076212 1 33 42 annotation2076269 1 SDS core consensus range2076269 1 35 40 annotation2076290 1 at > gg range2076290 1 39 40 annotation2076291 1 a > t range2076291 1 42 42 BBa_K208000 1 BBa_K208000 GFP 2009-10-07T11:00:00Z 2015-05-08T01:11:24Z plasmid GFP false false _310_ 0 2425 303 It's complicated true Mutate PstI sites false Elisabeth Linton annotation2062217 1 GFP Coding Region range2062217 1 1 720 annotation2062216 1 Start range2062216 1 1 3 BBa_K390010 1 BBa_K390010 hspA Type I Promoter from Synechocystis sp. PCC 6803 2010-07-31T11:00:00Z 2015-05-08T01:12:19Z Source was genomic sequence, but was assembled by annealing two olgionucleotides together. This is the promoter for the ''hsp''A ("heat shock protein A") gene in ''Synechocystis'' sp. PCC 6803. This gene is upregulated under heat stress conditions (preferred growth temperature of PCC 6803 is 30 degrees C, and heat stress occurs around 45 degrees C). It was suggested that it is recognized by SigB and SigA (Imamura S, and Asayama M. 2009. Sigma Factors for Cyanobacterial Transcription. Gene Regulation and Systems Biology 3:65-87). false false _518_ 0 6788 9 It's complicated false none false Cody Tramp annotation2076294 1 -10 box range2076294 1 27 32 annotation2076293 1 hspA promoter range2076293 1 1 38 annotation2076292 1 -35 box range2076292 1 6 11 BBa_K390043 1 BBa_K390043 hspA promoter, 5' UTR and consensus RBS, and GFP 2010-08-01T11:00:00Z 2015-05-08T01:12:20Z (coming soon) (coming soon) false false _518_ 0 6788 9 Not in stock false (coming soon) false Cody Tramp component2111304 1 BBa_K390010 component2111311 1 BBa_K390002 component2111319 1 BBa_K208014 annotation2111319 1 BBa_K208014 range2111319 1 102 958 annotation2111304 1 BBa_K390010 range2111304 1 1 38 annotation2111311 1 BBa_K390002 range2111311 1 47 95 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K390002_sequence 1 agtcagttccaatctgaacatcgacaaatacaaaaggaggtttaaccaa BBa_K390010_sequence 1 cgaatctaacctggaaggggaaattttaagatagaacc BBa_K390043_sequence 1 cgaatctaacctggaaggggaaattttaagatagaacctactagagagtcagttccaatctgaacatcgacaaatacaaaaggaggtttaaccaatactagatggctagcaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgctacatacggaaagcttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactcgagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggatccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgccctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K208014_sequence 1 atggctagcaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgctacatacggaaagcttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactcgagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggatccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgccctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K208000_sequence 1 atggctagcaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgctacatacggaaagcttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactcgagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggatccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgccctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z