BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_K391000 1 BBa_K391000 Construct for characterization of P2 activity in the presence of AIP. 2010-10-23T11:00:00Z 2015-05-08T01:12:20Z Assembled from registry parts. Generates GFP in the presence of AIP. Requires a system already containing the agr operon or at least agrAC. false false _531_ 0 6505 9 It's complicated true N/A false Phillip Chu component2095854 1 BBa_B0010 component2095856 1 BBa_B0012 component2095851 1 BBa_B0034 component2095849 1 BBa_I746104 component2095853 1 BBa_E0040 annotation2095856 1 BBa_B0012 range2095856 1 939 979 annotation2095851 1 BBa_B0034 range2095851 1 105 116 annotation2095854 1 BBa_B0010 range2095854 1 851 930 annotation2095853 1 BBa_E0040 range2095853 1 123 842 annotation2095849 1 BBa_I746104 range2095849 1 1 96 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_I746104 1 BBa_I746104 P2 promoter in agr operon from S. aureus 2007-08-30T11:00:00Z 2015-08-31T04:08:04Z The section of the sequence constituting the P2 promoter is subject to rather more debate than the sequences of the coding regions. [http://jb.asm.org/cgi/content/full/186/22/7549 Koenig, Robbin L., Ray, Jessica L., Maleki, Soheila J., Smeltzer, Mark S., Hurlburt, Barry K. Staphylococcus aureus AgrA Binding to the RNAIII-agr Regulatory Region J. Bacteriol. 2004 186: 7549-7555] shows the areas of the sequence to which phosphorylated AgrA binds while L Rao, R K Karls, and M J Betley: In vitro transcription of pathogenesis-related genes by purified RNA polymerase from Staphylococcus aureus. Bacteriol. 1995 May; 177(10): 2609???2614. shows the transcription start sites; we took the overall extent of the promoter region from that labelled in Morfeldt, E., K. Tegmark, and S. Arvidson. 1996. Transcriptional control of the agr-dependent virulence gene regulator, RNAIII, in Staphylococcus aureus. Mol. Microbiol. 21:1227???1237. (not available online). Released HQ 2013 The agr P2 operon is an autocatalytic sensory transduction system in Staphylococcus aureus. P2 promoter regulates the synthesis of AgrB (a transmembrane protein) and AgrD (precursor of AIP autoinducing peptide). AIP binds to AgrC, a membrane binding receptor and it phosphorylates AgrA. The phosphorylated AgrA increases the expression level from P2 promoter. false false _116_ 0 2121 9 In stock false Codon usage has been optimised for E. coli (which also seems to give good results for B. subtilis true Zhizhen Zhao BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_I746104_sequence 1 attaaatacaaattacatttaacagttaagtatttatttcctacagttaggcaatataatgataaaagattgtactaaatcgtataatgacagtga BBa_B0034_sequence 1 aaagaggagaaa BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_K391000_sequence 1 attaaatacaaattacatttaacagttaagtatttatttcctacagttaggcaatataatgataaaagattgtactaaatcgtataatgacagtgatactagagaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z