BBa_K391002 1 BBa_K391002 Forward Primer to PCR agrCA (with RBS) from S. aureus 2010-10-24T11:00:00Z 2015-05-08T01:12:20Z From complete sequence of S. aureus strain NCTC 8325. Accession: NC_007795. Available on NCBI. This is the forward primer for agrCA PCR. It contains EcoRI and XbaI sites due to the design of the primer. That is, it is BioBrick compatible. Along with the reverse agrCA primer, it is possible to obtain agrCA from S. aureus. Correct bands were obtained using these primers by UBC iGEM, but the cloning to a BioBrick vector failed. The orientation of agrCA is agrC first. false false _531_ 0 6505 9 It's complicated false This primer starts to PCR approximately 100 bp upstream of the start of agrC, at a putative RBS. This ensures the natural RBS is present. agrA likewise would contain its natural RBS because it is downstream of agrA on the genome. false Phillip Chu BBa_K391002_sequence 1 aggtggaattattaaatagttataattttg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z