BBa_K392005 1 BBa_K392005 yeast SUC2 leader sequence 2010-10-09T11:00:00Z 2015-05-08T01:12:20Z Composite part BBa_K392001 (LacI promoter + RBS) and registry part BBa_K103006 (OmpA w/ linker). LacI promoter with RBS, followed by OmpA outer membrane protein and linker for <i>Escherichia coli</i> cell surface display. false false _528_ 0 6220 9 It's complicated true Assembled by 3A method. false Tadashi Nakamura, Shuhei Yasumoto, Takahiro Saka, Saya Kakuda BBa_K392005_sequence 1 atgcttttgcaagctttccttttccttttggctggttttgcagccaaaatatctgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z