BBa_K395005 1 BBa_K395005 plux(rep)-middle 2010-10-01T11:00:00Z 2015-05-08T01:12:21Z test repressed by protein LuxR and 3OC6HSL. changed -35 and -10 consensus sequence of BBa_R0061 to that of J23108. true false _505_ 0 6593 9 Discontinued false test test false Eriko Uchikoshi annotation2082672 1 -10 range2082672 1 25 30 annotation2082671 1 -35 range2082671 1 1 6 BBa_K395005_sequence 1 ctgacacctgtaggatcgtacaggtataat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z