BBa_K395006 1 BBa_K395006 plux(rep)-small 2010-10-04T11:00:00Z 2015-05-08T01:12:21Z test repressed by protein LuxR and 3OC6HSL. changed -35 and -10 consensus sequence of BBa_R0061 to that of J23115. true false _505_ 0 6593 9 Discontinued false test test false Eriko Uchikoshi BBa_K395009 1 BBa_K395009 plux(rep)-R0061,small 2010-10-04T11:00:00Z 2015-05-08T01:12:21Z test Repressed by protein LuxR and 3OC6HSL. The consensus sequence of -35 and -10 is the same as that of BBa_J23115. false true _505_ 0 6593 9 Not in stock false test test false Eriko Uchikoshi BBa_K395006_sequence 1 tttatacctgtaggatcgtacaggtacaat BBa_K395009_sequence 1 tttatacctgtaggatcgtacaggtacaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z