BBa_K395008 1 BBa_K395008 Plux (rep) R0061middle 2010-10-04T11:00:00Z 2015-05-08T01:12:21Z test Repressed by protein LuxR and 3OC6HSL. The consensus sequence of -35 and -10 is the same as that of BBa_J23108. false false _505_ 0 6593 9 Not in stock false test test false Eriko Uchikoshi annotation2094270 1 -10 range2094270 1 25 30 annotation2094268 1 -35 range2094268 1 1 6 annotation2094269 1 lux-box range2094269 1 6 25 BBa_K395008_sequence 1 ctgacacctgtaggatcgtacaggtataat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z