BBa_I742156 1 BBa_I742156 crtZ native rbs 2007-10-23T11:00:00Z 2015-08-31T04:08:03Z Pantoea ananatis (formerly Erwinia uredovora) DSMZ 30080 (ATCC 19321). Accession: D90087. Native ribosome binding site for crtZ (beta-carotene hydroxylase) from Pantoea ananatis (formerly Erwinia uredovora) DSMZ 30080 (ATCC 19321). Accession: D90087. false false _123_ 0 837 163 Not in stock false A virtual part to be added to the coding sequence blunt (without a scar). false Chris French BBa_I742158 1 rbs+crtZ crtZ (beta-carotene hydroxylase) with native rbs 2007-10-23T11:00:00Z 2015-08-31T04:08:03Z Pantoea ananatis (formerly Erwinia uredovora) DSMZ 30080 (ATCC 19321). Accession: D90087. Released HQ 2013 crtZ (beta-carotene hydroxylase) from Pantoea ananatis (formerly Erwinia uredovora) DSMZ 30080 (ATCC 19321). Accession: D90087. Part of the carotenoid biosynthesis pathway. Converts beta-carotene to the yellow pigment zeaxnathin. false false _123_ 0 837 163 In stock true This part was made as a single biobrick rather than separate rbs and coding sequence, hence the use of blunt combination to generate the final sequence. true Chris French component1953815 1 BBa_I742157 component1953813 1 BBa_I742156 annotation1953813 1 BBa_I742156 range1953813 1 1 16 annotation1953815 1 BBa_I742157 range1953815 1 17 547 BBa_K395701 1 BBa_K395701 rbs+crtZ under plac promoter for double plasmids 2010-10-03T11:00:00Z 2015-05-08T01:12:22Z Gene coding sequences come from Pantoea ananatis (formerly Erwinia uredovora) (Accession number D90087), a type of Gram negative Enterobacteriaceae. This Composite Biobrick is created by standard assembly of Part BBa_R0010, Part BBa_I742158. This part contains crtZ, which works as the zeaxanthin biosynthesis pathway when add beta-carotene as a substrate. It is necessary to add either beta-carotene or the synthesis operon. false false _505_ 0 6372 9 It's complicated false &#12539;This operon is under IPTG inducible promoter. &#12539;I used this part with beta-carotene synthesis operon (BBa_K274210) as double plasmids in the project. false Yumiko Kinoshita component2219547 1 BBa_I742158 component2219537 1 BBa_R0010 annotation2219547 1 BBa_I742158 range2219547 1 209 755 annotation2219537 1 BBa_R0010 range2219537 1 1 200 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961225 1 -10 range1961225 1 161 166 annotation1961224 1 -35 range1961224 1 137 142 annotation1961227 1 start range1961227 1 173 173 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961226 1 LacI binding site range1961226 1 166 200 BBa_I742157 1 BBa_I742157 crtZ (beta-carotene hydroxylase) coding sequence 2007-10-23T11:00:00Z 2015-08-31T04:08:03Z Pantoea ananatis (formerly Erwinia uredovora) DSMZ 30080 (ATCC 19321). Accession: D90087. Coding sequence for crtZ (beta-carotene hydroxylase) from Pantoea ananatis (formerly Erwinia uredovora) DSMZ 30080 (ATCC 19321). Accession: D90087. Part of the carotenoid biosynthesis pathway. Converts beta-carotene to the yellow pigment zeaxanthin. false true _123_ 0 837 163 Not in stock false No special considerations. false Chris French annotation1953812 1 crtZ range1953812 1 1 528 BBa_I742157_sequence 1 atgttgtggatttggaatgccctgatcgttttcgttaccgtgattggcatggaagtgattgctgcactggcacacaaatacatcatgcacggctggggttggggatggcatctttcacatcatgaaccgcgtaaaggtgcgtttgaagttaacgatctttatgccgtggtttttgctgcattatcgatcctgctgatttatctgggcagtacaggaatgtggccgctccagtggattggcgcaggtatgacggcgtatggattactctattttatggtgcacgacgggctggtgcatcaacgttggccattccgctatattccacgcaagggctacctcaaacggttgtatatggcgcaccgtatgcatcacgccgtcaggggcaaagaaggttgtgtttcttttggcttcctctatgcgccgcccctgtcaaaacttcaggcgacgctccgggaaagacatggcgctagagcgggcgctgccagagatgcgcagggcggggaggatgagcccgcatccgggaagtaataa BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_K395701_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagctctaccggagaaattatgttgtggatttggaatgccctgatcgttttcgttaccgtgattggcatggaagtgattgctgcactggcacacaaatacatcatgcacggctggggttggggatggcatctttcacatcatgaaccgcgtaaaggtgcgtttgaagttaacgatctttatgccgtggtttttgctgcattatcgatcctgctgatttatctgggcagtacaggaatgtggccgctccagtggattggcgcaggtatgacggcgtatggattactctattttatggtgcacgacgggctggtgcatcaacgttggccattccgctatattccacgcaagggctacctcaaacggttgtatatggcgcaccgtatgcatcacgccgtcaggggcaaagaaggttgtgtttcttttggcttcctctatgcgccgcccctgtcaaaacttcaggcgacgctccgggaaagacatggcgctagagcgggcgctgccagagatgcgcagggcggggaggatgagcccgcatccgggaagtaataa BBa_I742156_sequence 1 ctctaccggagaaatt BBa_I742158_sequence 1 ctctaccggagaaattatgttgtggatttggaatgccctgatcgttttcgttaccgtgattggcatggaagtgattgctgcactggcacacaaatacatcatgcacggctggggttggggatggcatctttcacatcatgaaccgcgtaaaggtgcgtttgaagttaacgatctttatgccgtggtttttgctgcattatcgatcctgctgatttatctgggcagtacaggaatgtggccgctccagtggattggcgcaggtatgacggcgtatggattactctattttatggtgcacgacgggctggtgcatcaacgttggccattccgctatattccacgcaagggctacctcaaacggttgtatatggcgcaccgtatgcatcacgccgtcaggggcaaagaaggttgtgtttcttttggcttcctctatgcgccgcccctgtcaaaacttcaggcgacgctccgggaaagacatggcgctagagcgggcgctgccagagatgcgcagggcggggaggatgagcccgcatccgggaagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z