BBa_K398002 1 rubA3 Rubredoxin 2010-06-11T11:00:00Z 2015-05-08T01:12:22Z Genbank Rubredoxin 3 of Gordonia sp.TF6 false false _506_ 0 6320 9 It's complicated false Nucleotide sequence optimized for expression in E.coli false Mathias Voges annotation2070746 1 RubA3 range2070746 1 1 171 annotation2070747 1 start range2070747 1 1 3 annotation2070748 1 stop range2070748 1 169 171 BBa_K398002_sequence 1 atgtctaccttcagatgcccggtatgcgactacgtctacgacgaagctgctggtgctccgcgtgaaggtttcccgccgggtaccgcttgggctaccatcccggacgactggccgtgcccggactgcggtgttcgtgaaaaaatcgacttcgaaggtgttgctgttcgttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z