BBa_K398100 1 BBa_K398100 bbc1 2010-06-12T11:00:00Z 2015-05-08T01:12:22Z Genbank Protein from Chlamydomonas sp. W-80 that enhances salt-stress tolerance in E.coli. Nucleotide sequence optimized for expression in E.coli. false false _506_ 0 6320 9 It's complicated false None false Mathias Voges annotation2070760 1 bbc1 range2070760 1 1 627 annotation2070758 1 start range2070758 1 1 3 annotation2070759 1 stop range2070759 1 625 627 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K398102 1 BBa_K398102 J23100_J61100_bbc1_B0015 2010-10-09T11:00:00Z 2015-05-08T01:12:22Z Genbank A protein from Chlamydomonas sp. W80 that increases the salt tolerance of E.coli. This protein is called bbc1.The exact mechanism of the increased salt tolerance is as of yet unknown. But since bbc1 shows a high homology to RBS binding proteins, it is theorized that it may prevent/stabilize the folding structure of the ribosome under high salt stress conditions. false false _506_ 0 6352 9 It's complicated false Nucleotide sequence optimized for expression in E.coli false Eva Brinkman component2088267 1 BBa_B0012 component2088265 1 BBa_B0010 component2088260 1 BBa_J61100 component2088259 1 BBa_J23100 component2088264 1 BBa_K398100 annotation2088265 1 BBa_B0010 range2088265 1 697 776 annotation2088264 1 BBa_K398100 range2088264 1 62 688 annotation2088267 1 BBa_B0012 range2088267 1 785 825 annotation2088259 1 BBa_J23100 range2088259 1 1 35 annotation2088260 1 BBa_J61100 range2088260 1 44 55 BBa_J61100 1 BBa_J61100 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A {{JCA_Arkin_RBSFamily}} false true _95_ 0 483 95 In stock false N/A true John Anderson BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_K398102_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggggacatactagatggttcgtggtaacgacatgctgccgaacggtcacttccacaaaaaatggcagttccacgttaaaacctggttcaaccagccagctcgtaaacagcgtcgtcgtaacgctcgtgctgaaaaagctaaagctaccttcccgcgtccggttgctggttctctgaaaccgatcgttcgttgccagaccgttaaatacaacaccaaacagcgtctgggcaggggcttcaccctggaagagctgaaagaagctggtatcccggctaagttcgctccgaccgttggtatcgctgttgaccaccgtcgtaaaaaccgttctctggaaaccctgcaagctaacgttcagcgtctgaaaacctaccgtgcttctctggttatcttcccgcgtaacatgaaaaaaccgaaagctttcgaagcttctgctgctgactgctctgctgcttctcaggctaaaggtgaactgctgccgctgaaaggtaccaaaccggctctggaactggttaaaatcaccgctgacatgaaagaaggttctcagtacggtaaactgcgtatcgaacgtgttaacgctcgtctgaaaggtatgcgtgaaaaacgtgctgctgacgaagctgctaaaaaagacgacaaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_J61100_sequence 1 aaagaggggaca BBa_K398100_sequence 1 atggttcgtggtaacgacatgctgccgaacggtcacttccacaaaaaatggcagttccacgttaaaacctggttcaaccagccagctcgtaaacagcgtcgtcgtaacgctcgtgctgaaaaagctaaagctaccttcccgcgtccggttgctggttctctgaaaccgatcgttcgttgccagaccgttaaatacaacaccaaacagcgtctgggcaggggcttcaccctggaagagctgaaagaagctggtatcccggctaagttcgctccgaccgttggtatcgctgttgaccaccgtcgtaaaaaccgttctctggaaaccctgcaagctaacgttcagcgtctgaaaacctaccgtgcttctctggttatcttcccgcgtaacatgaaaaaaccgaaagctttcgaagcttctgctgctgactgctctgctgcttctcaggctaaaggtgaactgctgccgctgaaaggtaccaaaccggctctggaactggttaaaatcaccgctgacatgaaagaaggttctcagtacggtaaactgcgtatcgaacgtgttaacgctcgtctgaaaggtatgcgtgaaaaacgtgctgctgacgaagctgctaaaaaagacgacaaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z