BBa_K398206 1 BBa_K398206 AlnA generator (IPTG inducible) 2010-10-09T11:00:00Z 2015-05-08T01:12:22Z Accession no. AY033946 AlnA is a protein with emulsification activity originated from the natural oil degrading bacterium Acinetobacter radioresistens. It has been shown that this protein keeps its emulsifying capacitiesis when it is produced by other organisms, such as Escherichia coli. AlnA has an amphipathic structure, which allows it to form micelles that accumulate at the interface between liquids of different polarities such as water and oil. This process is based upon the ability of biosurfactants to reduce surface tension, blocking the formation of hydrogen bridges and certain hydrophilic and hydrophobic interactions. The emulsifier helps to disperse the oil by emulsifying the oil, thus increasing the surface area for the growth of microorganisms on hydrocarbons false false _506_ 0 6352 9 It's complicated true none false Eva Brinkman component2088271 1 BBa_R0011 component2088277 1 BBa_B0032 component2088285 1 BBa_B0012 component2088282 1 BBa_K398200 component2088283 1 BBa_B0010 annotation2088283 1 BBa_B0010 range2088283 1 1138 1217 annotation2088271 1 BBa_R0011 range2088271 1 1 54 annotation2088282 1 BBa_K398200 range2088282 1 83 1129 annotation2088277 1 BBa_B0032 range2088277 1 64 76 annotation2088285 1 BBa_B0012 range2088285 1 1226 1266 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation7027 1 BBa_B0032 range7027 1 1 13 BBa_K398200 1 BBa_K398200 AlnA 2010-06-12T11:00:00Z 2015-05-08T01:12:22Z Genbank An emulsifying protein present in the Alasan emulsifying complex which naturally occurs in Acinetobacter radioresistens. Nucleotide sequence optimized for expression in E.coli. false false _506_ 0 6320 9 It's complicated false None false Mathias Voges annotation2070762 1 stop range2070762 1 1045 1047 annotation2070763 1 AlnA range2070763 1 1 1047 annotation2070761 1 start range2070761 1 1 3 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation1999 1 lac O1 range1999 1 3 19 annotation2001 1 lac O1 range2001 1 26 42 annotation2002 1 -10 range2002 1 43 48 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2000 1 -35 range2000 1 20 25 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_K398206_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagtcacacaggaaagtactagatgaaactgtctcgtatcgctctggctatgctggttgctgctccgctggctgctgctaacgctggtgttaccatcaccccgctgatgctgggttacaccatgttcgacacccagcacaacaacggtggtaacgacggtgacctgaccgactctgttgaactggacgacgacctgttcgttggtgctgctctgggtgttgaactgaccccgtggctcggcttcgaagctgaatactctcagatcaaaggtgacacctctgttgctggtaacgaatacaaaggtgaaaacatcgctggtaacttctacgttacctctgacctgttcaccaaaaactacgactctaaaatcaaaccgtacgctctgctgggtgctggtcactacaaatacgagttcgacaccgacgctggtcgtgctggtcgtggtctggacgaagaaggtaccctgggtaacgctggtctgggtgctttctggcgtatcaacgacgctctgtctctgcgtaccgaagctcgtggtacctaccacttcgacgaacagttctggaactacaccgctctggctggtctgaacgttgttctgggtggtcacctgaaaccggctgctccggttgttgaagttgttccggttgaaccgaccccgatcgttgaaccgcagccgcaggaactgaccgaagacctgaacatggaactgcgtgttttcttcgacaccaacaaatctaacatcaaagaccagtacaaaccggaaatcgctaaagttgctgaaaaactggttgaatacccgaacgctaccgctcgtatcgacggtcacaccgacaacaccggcccgcgtgctctgaacgaacgtctgtctctggctcgtgctaactctgttaaatcttctctggttaacgaatacaacatcgacccgtctcgtctcactgctcagggcttcgcttgggaccagccgatcgctgacaactctaccaaagaaggtcgtgctatgaaccgtcgtgttttcgctaccatcaccggctctcgtaccgttgttgctcagccgggtcaggctcagtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0032_sequence 1 tcacacaggaaag BBa_K398200_sequence 1 atgaaactgtctcgtatcgctctggctatgctggttgctgctccgctggctgctgctaacgctggtgttaccatcaccccgctgatgctgggttacaccatgttcgacacccagcacaacaacggtggtaacgacggtgacctgaccgactctgttgaactggacgacgacctgttcgttggtgctgctctgggtgttgaactgaccccgtggctcggcttcgaagctgaatactctcagatcaaaggtgacacctctgttgctggtaacgaatacaaaggtgaaaacatcgctggtaacttctacgttacctctgacctgttcaccaaaaactacgactctaaaatcaaaccgtacgctctgctgggtgctggtcactacaaatacgagttcgacaccgacgctggtcgtgctggtcgtggtctggacgaagaaggtaccctgggtaacgctggtctgggtgctttctggcgtatcaacgacgctctgtctctgcgtaccgaagctcgtggtacctaccacttcgacgaacagttctggaactacaccgctctggctggtctgaacgttgttctgggtggtcacctgaaaccggctgctccggttgttgaagttgttccggttgaaccgaccccgatcgttgaaccgcagccgcaggaactgaccgaagacctgaacatggaactgcgtgttttcttcgacaccaacaaatctaacatcaaagaccagtacaaaccggaaatcgctaaagttgctgaaaaactggttgaatacccgaacgctaccgctcgtatcgacggtcacaccgacaacaccggcccgcgtgctctgaacgaacgtctgtctctggctcgtgctaactctgttaaatcttctctggttaacgaatacaacatcgacccgtctcgtctcactgctcagggcttcgcttgggaccagccgatcgctgacaactctaccaaagaaggtcgtgctatgaaccgtcgtgttttcgctaccatcaccggctctcgtaccgttgttgctcagccgggtcaggctcagtaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z