BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation7027 1 BBa_B0032 range7027 1 1 13 BBa_K398326 1 pCaiF Promoter of the CaiF protein 2010-06-13T11:00:00Z 2015-05-08T01:12:22Z Genbank Released HQ 2013 Promoter region from E.coli containing the binding site for the global regulator Crp. false false _506_ 0 6320 9 In stock true None false Hugo Federico Cueto Rojas annotation2090459 1 pCaiF range2090459 1 16 45 annotation2090458 1 Crp-cAMP range2090458 1 1 21 BBa_K398327 1 BBa_K398327 P(Caif)_B0032 2010-10-17T11:00:00Z 2015-05-08T01:12:22Z Genbank Promoter region from E.coli containing the binding site for the global regulator Crp. false false _506_ 0 6352 9 It's complicated false none false Eva Brinkman component2088753 1 BBa_K398326 component2088755 1 BBa_B0032 annotation2088753 1 BBa_K398326 range2088753 1 1 51 annotation2088755 1 BBa_B0032 range2088755 1 60 72 BBa_B0032_sequence 1 tcacacaggaaag BBa_K398326_sequence 1 aagcaggatttagctcacacttatcgacggtgaagttgcatactatcgata BBa_K398327_sequence 1 aagcaggatttagctcacacttatcgacggtgaagttgcatactatcgatatactagagtcacacaggaaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z