BBa_K398403 1 BBa_K398403 Prefoldin-beta generator 2010-10-11T11:00:00Z 2015-05-08T01:12:23Z The NCBI genomic sequence was enhanced for iGEM purposes Subunit alpha of the prefoldin from Pyrococcus horikoshii OT3. Four subunits alpha and two subunits beta create a chaperone that confers solvent tolerance to E. coli K12 false false _506_ 0 6321 9 It's complicated false Enhanced sequence for expression on E. coli K12, restriction sites for the enzymes XbaI, PstI, EcRI and SpeI are removed from the CDS. An extra XbaI site will be found between RBS and Promoter so you can increase the expression level of the protein by changing the promoter. false Hugo Federico Cueto Rojas annotation2085522 1 start range2085522 1 62 64 annotation2085524 1 BBa_K398401 range2085524 1 62 415 annotation2085519 1 BBa_J23100 range2085519 1 1 35 annotation2085520 1 BBa_J61107 range2085520 1 44 55 annotation2085525 1 XbaI site range2085525 1 36 41 annotation2085523 1 stop range2085523 1 413 415 annotation2085521 1 PhPFD-beta range2085521 1 62 415 BBa_K398403_sequence 1 ttgacggctagctcagtcctaggtacagtgctagcttctagagaaagaagagacttactagatgcagaacatcccgccgcaggttcaggctatgctgggtcagctggacacctaccagcagcagctgcaactggttatccagcagaaacagaaagttcaggctgacctgaacgaagctaaaaaagctctggaagaaatcgaaaccctgccggacgacgctcagatatacaaaaccgttggtaccctgatcgttaaaaccaccaaagaaaaagctgttcaggaactgaaagaaaaaatcgaaaccctggaagttcgtctgaacgctctgaaccgtcaggaacagaaaatcaacgaaaaagttaaagaactgacccagaaaatccaggctgctctgcgtccgccgaccgctggttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z