BBa_B0053 1 BBa_B0053 Terminator (His) 2004-01-29T12:00:00Z 2015-08-31T04:07:20Z Terminator from the E.coli His operon false true _1_ 0 24 7 Not in stock false false Caitlin Conboy annotation318602 1 stem_loop range318602 1 9 43 BBa_K407005 1 BBa_K407005 ACEYL CO REDUCTASE 2010-06-11T11:00:00Z 2015-05-08T01:12:25Z TEST PARIS TEST PARIS true false _521_ 0 7350 9 Discontinued false TEST PARIS false Johnson madrid component2070619 1 BBa_J63003 component2070621 1 BBa_B0056 annotation2070619 1 BBa_J63003 range2070619 1 1 18 annotation2070621 1 BBa_B0056 range2070621 1 27 98 BBa_J63003 1 Kozak & st designed yeast Kozak sequence 2006-10-10T11:00:00Z 2015-08-31T01:56:26Z consensus Kozak and start built from oligonucleotides Released HQ 2013 consensus Kozak sequence and start codon false false _97_ 0 545 97 In stock false designed such that fusion using fusion bricks assembly method leads to in frame translation true Caroline Ajo-Franklin annotation1902852 1 start codon range1902852 1 13 15 BBa_B0056 1 BBa_B0056 E. coli his operon terminator 2006-01-23T12:00:00Z 2015-08-31T04:07:20Z Bidirectional terminator derived from E. coli his operon. This part is a twin of BBa_B0053. true false _41_6_ 0 126 45 Discontinued false false Reshma Shetty annotation1790924 1 stem loop range1790924 1 9 43 BBa_B0056_sequence 1 tccggcaaaaaaacgggcaaggtgtcaccaccctgccctttttctttaaaaccgaaaagattacttcgcgtt BBa_K407005_sequence 1 cccgccgccaccatggagtactagagtccggcaaaaaaacgggcaaggtgtcaccaccctgccctttttctttaaaaccgaaaagattacttcgcgtt BBa_B0053_sequence 1 tccggcaaaaaaacgggcaaggtgtcaccaccctgccctttttctttaaaaccgaaaagattacttcgcgtt BBa_J63003_sequence 1 cccgccgccaccatggag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z